pegfp n1 flag  (Addgene inc)

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Experimental scheme for in vitro DNA pull-downs. b Whole cell extracts (WCE) from WT-MEF were incubated with streptavidin beads alone (mock) or with streptavidin beads-bound biotinylated dsDNA (b-dsDNA) or ssDNA (b-ssDNA) prior to in vitro DNA pull-down. Input and eluates were analyzed by Western blot (WB) using the indicated antibodies. c As in a , except that WCE from WT-RAW264.7 were used. d In vitro pulldown was performed as in c , except that beads-bound biotinylated dsRNA were also used. e In vitro pulldown was performed as in b , except that two different b-dsDNA were used. f Experimental scheme for in-cell DNA pulldowns. g WT-MEF were transfected with b-dsDNA or not (mock) before WCE preparation and streptavidin-affinity pull-down. Input and eluates were analyzed by WB using the indicated antibodies. h As in g , except that WCE were from WT-RAW264.7 cells transfected or not with b-dsDNA. i Immunofluorescence analysis was conducted on WT-MEF transfected or not with dsDNA for 6 h using anti-MeCP2 antibody, anti-dsDNA antibody and DAPI nuclear staining. BF, bright field. Images are representative of 3 independent experiments. Scale bar: 10 µm, except for Zoom: 5 µm. j Violin plots show the % MeCP2 intensity in the cytosol in experiments performed as in i ( n = 123 for Mock and for 120 dsDNA-transfected cells). k Pearson’s correlation coefficient was calculated on the cytosolic dsDNA and MeCP2 signals in WT-MEF treated as in j . l Immunofluorescence analysis of WT-MEF transfected or not with dsDNA and ssDNA for 6 h was performed using anti-MeCP2 antibody (enhanced signal or not) and DAPI nuclear staining. BF, bright field. Scale bars: 10 µm; Scale bars for Zoomed images: 5 µm. Images are representative of 3 independent experiments. m Violin plots show the % MeCP2 intensity in the cytosol and nucleus in experiments performed as in l ; n = 105 cells per condition. WB and images are representative of at least 3 independent experiments. Significance was assessed using two-sided Student t-test. ns: non-significant. * P < 0.05, ** P < 0.01, and **** P < 0.0001. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: In Vitro, Incubation, Western Blot, Transfection, Immunofluorescence, Staining

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a WT-MEF were stimulated with dsDNA for 3, 6, and 16 h prior to immunofluorescence analyses using an MeCP2 targeting antibody and DAPI nuclear staining. Scale bars: 10 µm. b Violin plots show the number of MeCP2 foci intensity in the cytosol and in the nucleus in experiments performed as in a ; n > 50 cells per condition. c Immunofluorescence analysis was performed on WT-MEF treated or not with 20 nM of Leptomycin B (LMB) prior to dsDNA transfection for 3 h using anti-MeCP2 antibody (enhanced signal or not) and DAPI nuclear staining. Scale bars: 10 µm; Scale bar for Zoomed images: 5 µm. Images are representative of two independent experiments. d Violin plots show the % of MeCP2 intensity in the cytosol and nucleus in cells treated as in c ; n = 95 cells per condition. e Immunofluorescence analysis was conducted on WT-MEF and MEF cGas−/− cells transfected or not with dsDNA for 6 h using anti-MeCP2 antibody, anti-dsDNA antibody and DAPI nuclear staining. BF, bright field. Images are representative of 3 independent experiments. Scale bar: 20 µm. f Immunofluorescence analysis was performed on WT-MEF and MEF Trex1-/- using anti-MeCP2 antibody and DAPI nuclear staining. Scale bars: 20 µm. Images are representative of two independent experiments. g Violin plots show the % of MeCP2 intensity in the cytosol and nucleus of cells treated as in f , n = 97 cells per condition. Significance was assessed using a two-sided Student t -test. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Immunofluorescence, Staining, Transfection

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Immunofluorescence analysis was conducted on MEF stably expressing a EGFP-cGAS construct (MEF EGFP-cGAS ) transfected or not with dsDNA for 6 h using anti-MeCP2 antibody and DAPI nuclear staining. Images are representative of 3 independent experiments. Scale bar: 20 µm; Scale bar for Zoom: 10 µm. (Right) Graph presents mean ± SEM. b Pearson’s correlation coefficient values for co-localization of cGas and MeCP2. p values were determined by Student’s t test. **** p < 0.0001; n = 12. c WT-MEF were transfected or not for 10 min, 30 min, 1 h, 3 h or 6 h with b-dsDNA before whole-cell extract preparation and pull-down using streptavidin-affinity beads. Input and eluates were analyzed by WB using the indicated antibodies. d WT-MEF were transfected or not with dsDNA before whole-cell extract preparation and immunoprecipitation using control IgG or a MeCP2-specific antibody. Input and immunoprecipitated material were analyzed by WB using the indicated antibodies. e MeCP2 knockout RAW264.7 were engineered to stably express FLAG-tagged MeCP2 prior to stimulation with dsDNA for 1, 3, 6 and 16 h. Whole cell extracts were subjected to FLAG immunoprecipitation prior to analysis of inputs and eluates by WB using the indicated antibodies. f Whole cell extracts prepared from WT-MEF or MEF cGas-/- cells were incubated with streptavidin beads alone or with streptavidin bead-bound b-dsDNA prior to pull-down. Input and eluates were analyzed by WB using the indicated antibodies. g Whole cell extracts prepared from MEF expressing a control non-targeting gRNA (MEF gCTRL ) or a MeCP2-targeting gRNA (MEF gMecp2 ) were incubated with streptavidin beads alone or with streptavidin bead-bound b-dsDNA prior to pull-down. Input and eluates were analyzed by WB using the indicated antibodies. All WB are representative of 3 independent experiments. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Immunofluorescence, Stable Transfection, Expressing, Construct, Transfection, Staining, Immunoprecipitation, Control, Knock-Out, Incubation

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Immunofluorescence analysis was conducted on MEF gCTRL or MEF gMecp2 after challenge or not with dsDNA for 6 h, using anti-cGas antibody and DAPI nuclear staining. Scale bar: 20 µm. Images are representative of 3 independent experiments. b Intracellular 2’3’-cGAMP levels were measured by ELISA following transfection or not with the dsDNA of MEF gCTRL or MEF gMecp2 . Graph presents fold increase 2’3’-cGAMP levels from 5 independent experiments. c MEF gCTRL or MEF gMecp2 were challenged or not with dsDNA for 6 h prior to gene expression analyses. Graph presents mean (±SEM) Ifnβ , Cxcl10 , Il6 and Isg15 mRNA levels ( n = 3 independent experiments). d MEF gCTRL or MEF gMecp2 were challenged with dsDNA for 24 h prior to collection of the supernatant and analyses using proteome profiler antibody arrays. The heat map presents data obtained from duplicate measurements. e representative images of arrays from d . f MEF gCTRL or MEF gMecp2 were challenged or not with dsDNA for 6 h in the presence or not of the H-151 Sting inhibitor. Graphs present mean (±SEM) Ifnβ , Il6 , Ccl5 , Oas1 , and Ifit2 mRNA levels and mean centroid analysis ( n = 3 independent experiments). One-way ANOVA with Sidak’s multiple comparison. g MEF overexpressing WT-MeCP2 (eMeCP2) or not (Empty) were transfected or not with dsDNA for 6 h prior to analysis of Ifnβ , Il6 , Cxcl10 , and Mecp2 mRNA levels. Graphs present mean (±SEM) from 3 independent experiments. h MEF gCTRL or MEF gMecp2 were challenged or not with poly(I:C) for 6 h prior to gene expression analyses. Graphs present mean (±SEM) Ifnβ , Oasl1 , Cxcl10 , and Isg15 mRNA levels ( n = 3 independent experiments). Significance was assessed using a two-sided Student t -test, except when otherwise stated. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Immunofluorescence, Staining, Enzyme-linked Immunosorbent Assay, Transfection, Gene Expression, Comparison

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Experimental scheme for b – h. b WT-MEF infected or not with a GFP-expressing HSV-1 KOS64 at 0.5 or 5 multiplicity of infection (MOI) were analyzed by immunofluorescence using anti-MeCP2 antibody and DAPI nuclear staining. Images are representative of 3 independent experiments. Scale bar: 50 µm. c Percent MeCP2 intensity in the cytosol in cells infected as in ( b ); n = 30 cells per condition. d As in c , except that cells were infected with the EGFP-expressing HSV-1 McKrae at 1 MOI; n > 50 cells per condition. e MEF gCTRL or MEF gMecp2 were infected or not with 5 MOI of HSV-1-KOS64 for 6 and 16 h prior to analysis of expression of indicated genes. Graphs present the mean (±SEM) of 3 independent experiments. f Mean (±SEM) plaques per cm2 after 72 h of infection of MEF gCTRL or MEF gMecp2 with 1 MOI of HSV-1 KOS64. 8 replicates, representative of 3 independent experiments. g WT-MEF were infected with conditioned media from HSV-1 KOS64-infected MEF gCTRL or MEF gMecp2 . The graph presents the mean (±SEM) percentage GFP-positive cells in recipient cells ( n = 3 independent experiments). h Representative images of cells in g . Scale bar: 400 µm. i Gene Set Enrichment Analysis (GSEA) was performed looking for Biological Process on DESeq2 results (log2foldchange > 0.01. GSEA p -value cut off = 0.05) from RNAseq data from RAW264.7 gCTRL or RAW264.7 gMecp2 . j Gene expression analysis was performed in the livers of male Mecp2 +/y and Mecp2 -/y mice. Graph presents mean (±SEM) fold increase gene expression in Mecp2 -/y mice as compared to Mecp2 +/y ; n = 4 mice per group. k Mean centroid expression was calculated on the expression of genes indicated in j ( n = 4 mice per group). l Significant DEGs involved in inflammation, interferon-beta, virus response, STING, and innate immunity between hippocampi from control and Mecp2 -silenced mice. X-axis: the False Discovery Rate (FDR). Gene symbols are reported for genes relevant to innate immunity. m Example Gene Set upregulated in patients with severe RTT symptoms. Significance was assessed using a two-sided Student T-test except for h , j and k . Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Infection, Expressing, Immunofluorescence, Staining, Gene Expression, Virus, Control